Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10986G4
Clone ID IST10986G4
Vector VICTR76
Project tigm

Sequence tag IST10986G4HMR1
Sequence
TTTTTTGGTTTTGCCTTCTATCTTTCCACCTCTTCTTCCTCTGTGTCTCTGCCTGTCTGTCTGTCTGTCTCTCTCTCTCT
GANNANNAN
Sequence Type genomic DNA
Unitrap ID UNI14730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106525734..106525815 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es