Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14220F11
Clone ID IST14220F11
Vector VICTR74
Project tigm

Sequence tag IST14220F11HMR1
Sequence
GTTAGGATTCTGATTCTNANANCTACCNAGGNACTGGGGAGAGGAGGGAGTGAATGTGGCCTGCCATCTGCACTTAGCCA
GCTGACTCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14220F11HMF1
Sequence
CTAACAAGTTCTCTGGACCAACCACAGATCTAGACACTGCTGCAGAGCTGTGGACACTTTTTCTCCTGTGCCAGTTCACC
TCCCAGGGCTCCCAGCCCTGACCAGTCAGTCGGCTTTCTTTCGGCTTTCGGTCTCAGAAGCACCGACAGTCCTGGGGGAG
CAGGCAGCAATGGTCACAGTTAGACCACCTGGTTCACAGTCCATATCTTTGTCTGCTGCCTCCTGTTCTGTGACTTCTGT
TTTCTCACCTGCGGGATGAGGGTGAGACCGGCTCCCTCCTGTGCTGTTAGGCAGGTTGTTAAGTCAGTGCTTATGCTAGT
CTCCAGCACACAGAGAGCATCATCTCACAGGTGAGCAGCCGGGATGTAACTCAGTTGGCAGANAGCTCACTTAGCATTCA
TGNNCCCCCAGTTTGATTCCCCGGCATGATATAAACTACGCCTGGTGCATTCGGAGGGCTAGAGAGGGANCGGCGGGGGG
ATCANCNGTTCGAGGCTNACCTGAGCTTACGTGANANACCTACTGTAAAACTTTNATTNAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI30528

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 79458798..79459351 528
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017639 (Rab11fip4) NM_175543 RAB11 family interacting protein 4 (class II) Gene [Source:MGI (curated);Acc:Rab11fip4-001]

 
Come back to gene ENSMUSG00000017639


For any suggestions or comments, please send an email to unitrap@crg.es