Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S2-1E1
Clone ID FHCRC-GT-S2-1E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S2-1E1
Sequence
ATGCAGGAGGGCAATTTTGTGCAGTTTTTTAACCTTAATGATGACCAGGTATTGTAACAGAGATTTTGATGATGAGAAGA
TCCTTATACAGCACCAAAAAGCAAAGCATTTTAAATGCCATATTTGTCATAAGAAATTATACACAGGACCTGGTTTAGCA
ATTCATTGCATGCAGGTCCATAAAGAAACCATAGATGCAGTACCAAATGCAATACCTGGGAGAACAGACATAGAGTTGGA
AATATATGGCATGGAAGGTATTCCAGAGAAAGATATGGATGAAAGACGGCGACTTCTTGAACAGAAAACACAAGAGAGTC
AGAAAAAGAAACAACAAGATGATTCTGATGAATATGATGATGATGAATCTGCAGCCTCAACTTCCTTTCAGCCACAGCCT
GTTCAACCTCAGCAAGGTTATATCCCACCAATGGCTCAGCCAGGACTGCCTCCAGTTCCAGGGGCACCAGGAATGCCTCC
AGGCATACCTCCATTGATGCCAGGTGTTCCTCCCCTGATGCCAGGCATGCCTCCAGTGATGCCAGGAATGCCGCCTGGAT
TGCATCATCAGAGAAAATACACCCAGTCATTTTGCGGTGAAAACATAATGATGCCAATGGGTGGAATGATGCCACCTGGA
CCTGGAATACCACCTCTGATGCCAGGTATGCCACCAGGTATGCCCCCACCTGTTCCACGTCCTGGAATTCCTCCAATGAC
TC
Sequence Type genomic DNA
Unitrap ID UNI14668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 80199359..80205381 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017421 (Zfp207) NP_035881 zinc finger protein 207 Gene [Source:MGI (curated);Acc:Zfp207-002]

 
Come back to gene ENSMUSG00000017421


For any suggestions or comments, please send an email to unitrap@crg.es