Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AB0082
Clone ID AB0082
Vector pGT0lxr
Project sanger

Sequence tag AB0082
Sequence
CCTCGCTCTCTCTTTTGACGCCTCTCCCCTTAATCATATTCTGATCTGCCCCCAGGCTCTGTCGGATGGACCTCTTCATA
ACCATTTCTCACATATCATCTCTCTCCTGCTCGTGGCGAGCGCGGCCCGGAGCGGCCGGGCGGGGGAGGGAGCAGGCCGA
GCGGCGAGCTGAGGCGGCCGAGGGGCTGGTCCAGGCGCGGCCGCTAAGAGGAGACCAAGAGGCGGGGGCTGCACTTGACA
ACCAGCATGCCGAGATG
Sequence Type mRNA
Unitrap ID UNI1445

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 84320879..84321021 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028487 (Bnc2) NM_172870 basonuclin 2 Gene [Source:MGI (curated);Acc:Bnc2-001]

 
Come back to gene ENSMUSG00000028487


For any suggestions or comments, please send an email to unitrap@crg.es