Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S2-11C1
Clone ID FHCRC-GT-S2-11C1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S2-11C1
Sequence
GACTTGCTGTGACCTCCGGGAACATCTCTGCACACCCCACAACCGCGGCCTCAACAACAAATGTTTCGACGACTGCATGT
GCATGGAAGGGCTGCGTTGCTATGCCAAATTCCACCGGAACCGCAGGGTCACTCGGAGGAAGGGGCGCTGCGTGGAACCA
GAGACAGCCAACGGGGACCAGGGATCTTTCATCAACATCTAGTGCCCTAGTGGTGCCTCCCCACTGGCCCGGGATCTGAG
CCAGGGAGGTTTAGGACAAACAGGACCGTGTTAGTAACTAGCTCAGCTTGGGCTGAGTAGGGAACCAATGGCTGAGGCAG
CAGGTGTACGCCCAGTACACTCAACCACAAGCTGGAGAGCGGTTTAGCAGAGAGCAGTGCGCCAGAGCCCTCCCGCCCGC
AGTCCGGGGTGGGACCCCCACCTGCTCCCTGATTCTGCTCGACTCGGCGGTGGCTTTGTGTAGCGCACCCTCTTCTGCTC
GACACCAGCATTGCAGCAGTTTCAATTGGCGAAAACAAGAGGCTTCCTTGACTGAAAAGGGTTGGAAAGAGAGGGGACAA
CTGACAGTCCTGGATCTGGAATGCTATGTCGCAGGCAAACGCCAAGCGCCACATGTATTTTTACTGAATTTCCACAGAGA
CCGTGTACCAAAGCCTTGCACGGTCCAGGCAAGTGCTCGACTACTGAGTTACGTGCTAACTTGGTCTGGGCTTCAAAGTC
TCCA
Sequence Type genomic DNA
Unitrap ID UNI14670

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 147474833..147482131 550
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029005 (2610109H07Rik) NM_027426 RIKEN cDNA 2610109H07 gene Gene [Source:MGI Symbol;Acc:MGI:1917683]

 
Come back to gene ENSMUSG00000029005


For any suggestions or comments, please send an email to unitrap@crg.es