Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S2-11A1
Clone ID FHCRC-GT-S2-11A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S2-11A1
Sequence
ACTTTTCGAAAAGAAGATGGACCAGCCTAGTGGGAGAAGTTTCATGCAAGTATTGTGTGAAAAATACAGTCCTGAAAACT
TCCCTTACCGCCGTGGCCCTGGGGTGGGAGTCCATGTCCCAGCCACTCCCCAGGGCTCGCCTATGAAAGATCGCCTCAAC
CTCCCGAGCATGCCTGTCTCCCTCTCTCCCTCCCCCTCCTCCTCCCTCTTCCCCCCTCTCCCCTACCCCCCAAAGATGAC
AGAAACCACCGGCTTCTTACTGTGTCATTGGGATTTGTCAGCCACTGGGCTCTTTCCTGCTAAGCCCAAAGACAGTGTGG
TCCCTCAGAGGGGTGATGCAGTGTTCACATCCAGAGATGGGGTCCTCCTAGGGAGGGATGGGGCTCCTCCTAGGGAGGGA
TGGGGTCCTCCTAGGGAGGGATGGGGGTCCTCCTAGGGAGGGCCTTCTCTGGCTCTTCCTTCCCTGCCCCTCCTCCTCCT
CCTTTCCATTTGGGGGTCCTGGGTCTGGTTTTCATTCTGACTTGTACCCACTTACCTGGTAGTTTTACTCTGTTCATAAT
TTAACTTGGTTTTGTTGTTGGTGTGTCTGTTTTTCCCCCTCTCGTTCCCAGTTTTAAGTGACTTTGAGTATTTTAAGCAT
TTCCAGTCTGATTCTGATCTCAGGAACTCGGTTAGGTTTTAGAGAGAAGTAGGCGGAGTGTTAGCCCTGGGAAACTCGCT
ACT
Sequence Type genomic DNA
Unitrap ID UNI14671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42223126..42259845 555
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037287 (Tbcel) NM_173038 tubulin folding cofactor E-like Gene [Source:MGI Symbol;Acc:MGI:1925543]

 
Come back to gene ENSMUSG00000037287


For any suggestions or comments, please send an email to unitrap@crg.es