Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11162E8
Clone ID IST11162E8
Vector VICTR76
Project tigm

Sequence tag IST11162E8HMF2
Sequence
NTANAGCTTTTTTGAGGGGGTGTGGTGGGGGAGTGAGGTATGGATGTGTCTCATANAAAATATCTACCACTGTTTCTTTT
CTTCTTGATGCCCCTGATGCCCCTTGTGTTTGGATTGGCTGCTGACTGGATCTAATGTGGCCCCTGCCCTCTAAGAACTG
TANAGCCTATTTANGAAATGGACAAGTATTTAANAATCTCTCACATAAAATGAAAAATATAATTTTCTCCACACAAAACA
TTANTANNACTGTCCCCATTGTAATGGCATGATGCANNTTCCCCCGCATGGGTTTTTTGTTTGGTTTCCCTTTTCCCCCC
TGTNCTGNAAATTGAACCCNAGCCCTCAAGCATGGAAGGCAAGCGCTCTACCACTGAATNACACTTCTTCCTAATCAGGA
TTGATGTGTGCGCTCAGTCACTCACTGACTCTTCACAGCAACTGANAAAGGAGCTAGCAATTAAAGAAGCACAACAAANN
TAGTGACCNGANGGGANNNGCCC
Sequence Type genomic DNA
Unitrap ID UNI13659

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134171874..134172368 457
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030677 (Kif22) NM_145588 kinesin family member 22 Gene [Source:MGI Symbol;Acc:MGI:109233]

 
Come back to gene ENSMUSG00000030677


For any suggestions or comments, please send an email to unitrap@crg.es