Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S2-10F1
Clone ID FHCRC-GT-S2-10F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S2-10F1
Sequence
AGACGTCCATTGTATCTTCATGTTCAGGGACAGACACGGGAATTAGTAGACAGAGCTGTAAACCGAATCAAAGAAATAAT
CACCAATGGAGTGGTGAAGGCTGCCACAGGGACAAGTCCAACTTTCAATGGTGCAACAGTCACTGTCTATCACCAGCCAG
CTCCCATTGCTCAGTTATCACCTGCTATTAACCAGAAGCCTTCCTTCCAGTCCGGAATGCATTATGTTCAAGATAAACTA
TTTGTGGGTCTAGAACATGCGGTGCCCACTTTTAATGTTAAAGAGAAAGTAGAAGGTCCAGGCTGCTCTTATTTGCAACA
CATTCAAATTGAAACTGGTGCCAAAGTCTTTCTACGAGGGAAAGGCTCAGGCTGCATTGAGCCAGCGTCAGGCCGAGAGG
CTTTTGAACCCATGTATATTTATATCAGTCATCCCAAACCTGAAGGCCTGGCTGCTGCCAAGAAGCTCTGCGAGAATCTC
TTACAAACAGTTCATGCTGAGTATTCTAGATTTGTGAATCAAATTAATACTGCTGTACCATTACCAGGCTATACACAACC
CTCTGCTATAAGTAGTATCCCTCCTCAACCACCATATTATCCATCCAATGGCTATCAGTCTGGTTACCCTGTTGTTCCCC
CTCCTCAGCAGCCAGTTCAGCCTCCCTACGGAGTACCAAGCATAGTGCCACCAGCTGTTTCATTGGCACCTGGAGTCTTG
CC
Sequence Type genomic DNA
Unitrap ID UNI14672

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88497002..88504357 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028060 (2810403A07Rik) NM_028814 RIKEN cDNA 2810403A07 gene Gene [Source:MGI Symbol;Acc:MGI:1921450]

 
Come back to gene ENSMUSG00000028060


For any suggestions or comments, please send an email to unitrap@crg.es