Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11377F7
Clone ID IST11377F7
Vector VICTR76
Project tigm

Sequence tag IST11377F7HMF1
Sequence
CCACACCCATTAAAAAACAAATAAACAAACAAACAAAAACAACTAATGGCTGGGAATGCAGGGGTCCAGCCCACGTCACC
TCCCTGTTTTGGTAAATCTCCAACCCAAATATGCCCTGTCAATGAAAACATGACTCAGTTAATATGAATACATGCTGTGC
ACCTANATTGGA
Sequence Type genomic DNA
Unitrap ID UNI25726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97636065..97636235 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018543 (1700001P01Rik) NM_028156 RIKEN cDNA 1700001P01 gene Gene [Source:MGI Symbol;Acc:MGI:1919465]


Sequence tag IST11377F7BBF1
Sequence
CCACACCCATTAAAAAACAAATAAACAAACAAACAAAAACAACTAATGGCTGGGAATGCAGGGGTCCAGCCCACGTCACC
TCCCTGTTTTGGTAAATCTCCAACCCAAATATGCCCTGTCAATGAAAACATGACTCANTTAATATGAATACATGCTGTGC
ACCTAGATTGGCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI25726

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97636057..97636235 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018543 (1700001P01Rik) NM_028156 RIKEN cDNA 1700001P01 gene Gene [Source:MGI Symbol;Acc:MGI:1919465]

 
Come back to gene ENSMUSG00000018543


For any suggestions or comments, please send an email to unitrap@crg.es