Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14303G5
Clone ID IST14303G5
Vector VICTR74
Project tigm

Sequence tag IST14303G5HMF1
Sequence
GTTCCATCACAAGGACCAGGAGACAAGCCCATCCCCACCTACAACTCTGGAGCTCATTAACTTCACCTTCCATCAGTGAT
CAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509586..84509670 85
NO GENE  


Sequence tag IST14303G5HMR1
Sequence
GAACCCTACTCTGATGTTCCCTTCTCTGTTTGCAGCTTTCAGTCCCTGGAGATGTTGAAGCATTTATGATGGTGCATGGC
CN
Sequence Type genomic DNA
Unitrap ID UNI34515

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84509509..84509589 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000076437 (2700094K13Rik) NM_001033166 RIKEN cDNA 2700094K13 gene Gene [Source:MGI Symbol;Acc:MGI:1919907]

 
Come back to gene ENSMUSG00000076437


For any suggestions or comments, please send an email to unitrap@crg.es