Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-12B1
Clone ID FHCRC-GT-S1-12B1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-12B1
Sequence
GTTTCCCCTCAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACCAACAGATAAGAAACAGAAAGTTGAACG
CAGTTCATCGCATGATTTTGACCCCACAGGTCTTGTTCAGCGCTGTGTGATCATCCAGAAAGACGACAATGGCTTCGGGC
TGACAGTCAGTGGAGACAATCCGGTCTTCGTACAATCTGTCAAAGAAGATGGAGCAGCCATGCGTGCTGGAGTACAAACA
GGTGATCGAATCATCAAGGTAAAGCAGTCGGTGTCGTGGGAGTCCTGTGGGCTGCAGCGCCTGCCTCGGCTGTAGGCCTC
TTTCCACCTGGTTCTTTAGAAAAAGCAGCTCCCTGCCTTTCATACACGCTTTCTCCATTTGTTTCAAAGTTCACATTAAC
CCTTACTGAAAGGCACAATAAAGGCTTGTTTAAATGGAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14673

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42834083..42852370 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059495 (Arhgef12) NP_081420 Rho guanine nucleotide exchange factor (GEF) 12 Gene [Source:MGI Symbol;Acc:MGI:1916882]

 
Come back to gene ENSMUSG00000059495


For any suggestions or comments, please send an email to unitrap@crg.es