Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-11F1
Clone ID FHCRC-GT-S1-11F1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-11F1
Sequence
GTCAGTTGGTGAGATGCTGCTTTTCCAGAGGTCACTCGTTACATGGACTTCAAAGTGATTGAGGGAAGCTTTGTCTACAA
GGGAGGGAAAATCTACAAGGTTCCTTCCACTGAAGCAGAAGCCCTGGCATCTAGCTTAATGGGACTGTTTGAGAAACGCC
GTTTCAGGAAGTTCCTGGTTTATGTTGCCAACTTTGATGAAAAAGATCCTAGAACTTTCGAGGGTGTTGATCCTAAGAAG
ACCTCCATGAGAGATGTGTATAAGAAGTTTGATTTGGGCCAAGATGTTATAGACTTTACTGGCCATTCTCTTGCACTGTA
CAGAACAGATGACTACTTAGATCAGCCGTGTTGTGAAACCATTAATAGAATTAAACTTTACAGCGAGTCTTTGGCAAGAT
ACGGTAAAAGCCCGTACCTGTATCCGCTTTATGGTCTTGGAGAATTGCCGCAAGGATTTGCAAGGTTAAGTGCCATATAT
GGAGGTACCTACATGTTGAATAAACCAATTGAAGAAATCATTGTGCAAAATGGAAAAGTGGTTGGTGTAAAATCCGAAGG
AGAGATTGCTCGCTGTAAACAGCTCATCTGTGATCCCAGCTATGTAAAAGATCGGGTTGAAAAAGTGGGCCAGGTAATCA
GAGTGATCTGTATCCTTAGCCACCCTATCAAGAACACCAACGATGCCAACTCCTGCCAGATCATCATTCCACAGAACCAA
GTCAA
Sequence Type genomic DNA
Unitrap ID UNI14674

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3553658..3561272 201
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021218 (Gdi2) NM_008112 guanosine diphosphate (GDP) dissociation inhibitor 2 Gene [Source:MGI Symbol;Acc:MGI:99845]

 
Come back to gene ENSMUSG00000021218


For any suggestions or comments, please send an email to unitrap@crg.es