Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-11D1
Clone ID FHCRC-GT-S1-11D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-11D1
Sequence
TATGGTGATAAAGATAAACGGCGACATTGTTTTGCTACCTGGAAGAATATTTCTGGTTCCATTGAAATAGTGAAGCAAGG
TTGTTGGCTGGATGATATCAACTGCTATGACAGGACTGATTGTATAGAAAAAAAAGACAGCCCTGAAGTGTACTTTTGTT
GCTGTGAGGGCAATATGTGTAATGAAAAGTTCTCTTATTTTCCGGAGATGGAAGTCACACAGCCCACTTCAAATCCTGTT
ACACCGAAGCCACCCTATTACAACATTCTGCTGTATTCCTTGGTACCACTAATGTTAATTGCAGGAATTGTCATTTGTGC
ATTTTGGGTGTACAGACATCACAAGATGGCCTACCCTCCTGTACTTGTTCCTACTCAAGACCCAGGACCACCCCCACCTT
CCCCATTACTAGGGTTGAAGCCATTGCAGCTGTTAGAAGTGAAAGCAAGGGGAAGATTTGGTTGTGTCTGGAAAGCCCAG
TTGCTCAATGAATATGTGGCTGTCAAAATATTTCCAATACAGGACAAACAGTCCTGGCAGAATGAATATGAAGTCTATAG
TCTACCTGGAATGAAGCATGAGAACATACTACAGTTCATTGGTGCAGAGAAAAGAGGCACCAGTGT
Sequence Type genomic DNA
Unitrap ID UNI14675

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 48725904..48747752 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052155 (Acvr2a) NM_007396 activin receptor IIA Gene [Source:MGI (curated);Acc:Acvr2a-001]

 
Come back to gene ENSMUSG00000052155


For any suggestions or comments, please send an email to unitrap@crg.es