Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10087C11
Clone ID IST10087C11
Vector VICTR75
Project tigm

Sequence tag IST10087C11BBR1
Sequence
ATAGTATTGGTGAAATTTCTTTGTAATGCCTAAGAAAATGGGATTTCTAATGTGTCTATTGATACAAATATATTTCTTTT
TTTTTTAATTT
Sequence Type genomic DNA
Unitrap ID UNI34516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 56021478..56021567 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071533 (Pcnp) NM_001024622 PEST proteolytic signal containing nuclear protein Gene [Source:MGI (curated);Acc:Pcnp-008]

 
Come back to gene ENSMUSG00000071533


For any suggestions or comments, please send an email to unitrap@crg.es