Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10545G2
Clone ID IST10545G2
Vector VICTR76
Project tigm

Sequence tag IST10545G2HMR1
Sequence
NCAAAACTACTAAGGTTATTAAAACCAAAGAAAGTCTGGGAGAAGAAACTGCCGGTCTTCAAAGGTATCACCTAAATGTA
ACATTCCTTTGGTGAGATTCTGGATAAGAAAAAAATCTAAGGAGACCTGGGGAATATATGC
Sequence Type genomic DNA
Unitrap ID UNI12212

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 44883120..44883258 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071856 (Mcc) NP_001078843 mutated in colorectal cancers Gene [Source:MGI Symbol;Acc:MGI:96930]

 
Come back to gene ENSMUSG00000071856


For any suggestions or comments, please send an email to unitrap@crg.es