Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-8H1
Clone ID FHCRC-GT-S1-8H1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-8H1
Sequence
ATTATTTGCGCCTCATCTTGGTGAGTGGGAAGACGAAAGAGTTCCTCTTCTCCCCAAACGACTCTGCCTCTGACATCGCA
AAGCACGTGTATGACAACTGGCCCATGGACTGGGAAGAAGAGCAGGTCAGCAGCCCAAACATTCTTCGACTCATTTATCA
AGGCAGATTTCTACATGGAAACGTCACCCTAGGAGCATTAAAACTTCCTTTTGGCAAAACAACAGTGATGCATTTGGTGG
CCAGAGAGACCCTGCCAGAGCCCAACTCACAAGGTCAGAGAAATCGGGAGAAAACTGGTGAGAGCAACTGCTGTGTGATC
CTGTAGCGTCGCCAGCACAGATGTGGCAGTTTGTTGGCACTGCGGGGACAGAGGAGACTCAGCAGCTTCCAACACCTGTA
GGACAGTCGCCAGCACATCCGTGGGACTGAATCACTCATGAACTCTGTCATCTCCTCTCACAAAGTAAAAAGAACCAAGA
ACAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI3005

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 149317554..149323574 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001687 (Ubl3) NM_011908 ubiquitin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1344373]

 
Come back to gene ENSMUSG00000001687


For any suggestions or comments, please send an email to unitrap@crg.es