Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12452G12
Clone ID IST12452G12
Vector VICTR76
Project tigm

Sequence tag IST12452G12BBF1
Sequence
GCTTGGCGCGGACTCCTACTATGGGCTGGCTGCATTGGGAACGTTTCATGTGCAACCTTGACTGCCAANAANAGCCTGAT
GCCTGCATAAGGTATGAATGAGATGTGGAGTGATCCTTCCTCTTTCCGTGTGTTTGTGTGGGTGTCTTTGGTAGAAGGAG
TGGAGCATTTGAGCTGGAGGGGTAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI18639

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 131135179..131135367 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031266 (Gla) NM_013463 galactosidase, alpha Gene [Source:MGI (curated);Acc:Gla-001]

 
Come back to gene ENSMUSG00000031266


For any suggestions or comments, please send an email to unitrap@crg.es