Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14281A5
Clone ID IST14281A5
Vector VICTR74
Project tigm

Sequence tag IST14281A5HMR1
Sequence
ACTGAAAGGTNNGGAGAGGAAGTTCTGGGAGGTTTTATGAGCTCCAGANCAAAAGAGGAGCCTGAGGGATAGCTGATATC
TTAGTGAGCGTTCTGGGAGGATTAGGCCAGGTTCTTTTAGAAGCTTTTACATAAAAGAGGAATAAGGATAAGGTGAGAGG
TTTAGAATCAGGCAATGGGAGGGTGGGAACTCCAATTTAATCNCTTTANTGGANGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292457..57292673 205
 
EST/CDNA Est Name
  BY349020.1 - BY352340.1 - BY347642.1


Sequence tag IST14281A5HMF1
Sequence
CAGTAAGGTCCCATAGTTGTGGAGTCTTTGCCTGGAAACCTCAGCGAGCTGGTCCTGTCACCCACCTCACCCTGGAAGGT
CTCAGCCTCCTTGTCCCCTAGACACGTCTTCACCTCCTATGGAAGCCAGGTTCCCCGCATCTCTACCTTCCCCCACCGGC
TGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292295..57292460 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST14281A5BBF1
Sequence
CAGTAAGGTCCCATAGTTGTGGAGTCTTTGCCTGGAAACCTCAGCGAGCTGGTCCTGTCACCCACCTCACCCTGGAAGGT
CTCAGCCTCCTTGTCCCCTAGACACGTCTTCACCTCCTATGGAAGCCAGGTTCCCCGCATCTCTACCTTCCCCCACCGGC
TGGCCACTTCCTGGCTTGGCCTGGGGCCAAGTAAATGAATATTGAGTCAATGGGCCGGAACTCCTTTGCCAAAGTAATAA
CAAAGGAAGCCAAAAGTAATTATAAACAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57292187..57292460 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]

 
Come back to gene ENSMUSG00000038764


For any suggestions or comments, please send an email to unitrap@crg.es