Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12396D10
Clone ID IST12396D10
Vector VICTR76
Project tigm

Sequence tag IST12396D10BBF1
Sequence
CAATAATAATAATGATAGCCAGTAAAAAGACCTGGAACCGCTAAAGCATTTTTAAACATGTCAGATCGCCATGCATCAAC
TTAATATTAAGTTTCCTGGGGCATATTTCACTACCCACTGCCATCTGGCTGTTATGCTGTCACTTGTAACTCAAGACCTT
GGTTATCATATGGAATTGTGTTGCACAAATCAACTATGTCTTATGTATGCAAAAATATTTTCTAACCAACTGTGGATAGA
CATTTTGCCAGTCCAGCTAAATAATTTATCTTGGCCATTTTTAAGAAAAAGATTTTCTTTTTTAAATTATGTGTATATGT
GTTTATGTGTGGGTGTGCGGACATGAGTACAGTGCCTGTGGAAGCCAGGAGAGGATATTTCACACACACACACACACACA
CACACACACNNNANTGTNNNCNNAN
Sequence Type genomic DNA
Unitrap ID UNI34520

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 69443850..69444258 409
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069601 (Ank3) NM_170687 ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]


Sequence tag IST12396D10HMF1
Sequence
CAATAATAATAATGATAGCCAGTAAAAAGACCTGGAACCGCTAAAGCATTTTTAAACATGTCAGATCGCCATGCATCAAC
TTAATATTAAGTTTCCTGGGGCATATTTCACTACCCACTGCCATCTGGCTGTTATGCTGTCACTTGTAACTCANNACCTT
GGTTATCATATGGAATTGTGTTGCACAAATCAACTATGTCTTATGTATGCAAAAATATTTTCTAACCNNCTGTGGATANA
CATTTTGCCANTCCNNCN
Sequence Type genomic DNA
Unitrap ID UNI34520

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 69443850..69444103 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069601 (Ank3) NM_170687 ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]

 
Come back to gene ENSMUSG00000069601


For any suggestions or comments, please send an email to unitrap@crg.es