Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12337D6
Clone ID IST12337D6
Vector VICTR76
Project tigm

Sequence tag IST12337D6HMF1
Sequence
TTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAAGGAGATCTGACGCCCTCTTCT
GGAGTGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATCTTTAAAAAAAAAAAAAAAAAAAAAAAAA
AAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161875: 123623..360604 134
NO GENE  


Sequence tag IST12337D6BBF1
Sequence
TTCCGAAGGTCCGGAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCATCCGTAAGGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI1659 UNI28434 UNI30594 UNI30791 UNI34522

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6138376..6138443 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 78079928..78079995 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025429 (Pstpip2) NM_013831 proline-serine-threonine phosphatase-interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1335088]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 46320596..46320663 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023953 (Polh) NM_030715 polymerase (DNA directed), eta (RAD 30 related) Gene [Source:MGI Symbol;Acc:MGI:1891457]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80027486..80027553 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042428 (Mgat3) NM_010795 mannoside acetylglucosaminyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:104532]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19068578..19068645 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021775 (Nr1d2) NM_011584 nuclear receptor subfamily 1, group D, member 2 Gene [Source:MGI Symbol;Acc:MGI:2449205]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79508100..79508167 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114079696..114079763 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033545 (Znrf1) NM_133206 zinc and ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2177308]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 91607668..91607735 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 153502197..153502264 68
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180925039..180925106 68
NO GENE  

 
Come back to gene ENSMUSG00000033545


For any suggestions or comments, please send an email to unitrap@crg.es