Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-6E1
Clone ID FHCRC-GT-S1-6E1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-6E1
Sequence
ATTTGATAATGGGCTGCATTAAAAGTAAAGAAAACAAAAGTCCAGCCATAAAATACACACCGGAAAATCTTACAGAGCCT
GTAAGCCCAAGTGCCAGTCATTATGGAGTGGAACATGCTACAGTTGCCCCGACCTCTTCCACAAAGGGAGCATCAGTTAA
TTTTAACAGTCTTTCCATGACACCCTTTGGAGGGTCCTCAGGGGTGACTCCTTTTGGAGGAGCGTCTTCCTCATTCTCAG
TGGTGTCAAGTTCATATCCTACAGGTTTAACAGGTGGTGTCACTATATTTGTGGCCTTGTATGATTATGAAGCTAGAACT
ACAGAAGACCTTTCCTTTAAGAAGGGTGAACGATTTCAAATAATTAACAATACGTAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI14684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 32942704..32947484 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014932 (Yes1) NM_009535 Yamaguchi sarcoma viral (v-yes) oncogene homolog 1 Gene [Source:MGI Symbol;Acc:MGI:99147]

 
Come back to gene ENSMUSG00000014932


For any suggestions or comments, please send an email to unitrap@crg.es