Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-5D1
Clone ID FHCRC-GT-S1-5D1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-5D1
Sequence
ATGACCACAAATCTAGAACCAAAGAACACGATGCACTAGCAGACAGACTCGAAGCTAGAGACTGGAGATCTGGGTTCTTT
TGTCCTTCCTCAAACTGATTTTGCAGCCACGGAGAGGAAGGGGAGATGGAAGGTGAGGCGGTTGAAGCCATTGTGGAGGA
GTCTGAAACTTTCATTAAAGGAAAAGAAAGAAAGACTTACCAGAGACGCCGGGAAGGGGGCCAGGAAGAAGATGCTTGCC
ACCTGCCCCAGAACCAGACAGATGGGGGTGAGGTGGTCCAGGATGTCAACAGCAGTGTACAGATGGTAATGATGGAACAG
CTGGATCCTACCCTTCTCCAGATGAAGACTGAAGTCATGGAGGGTACAGTGGCTCCGGAAGCAGAGGCTGCAGTGGACGA
TACCCAGATCATAACCTTGCAGGTTGTAAATATGGAGGAACAGCCCATTAACATAGGAGAGCTTCAGCTTGTCCAAGTAC
CTGTTCCTGTGACGGTACCTGTTGCTACTACTTCAGTAGAAGAACTTCAGGGGGCTTATGAGAATGAAGTGTCTAAAGAG
GGCCTTGCAGAAAGTGAACCGATGATATGTCACACCTTACCTTTGCCTGAAGGATTTCAGGTGGTGAAAGTGGGGGCCAA
TGGAGAAGTGGAGACACTAGAGCAGGGCGAGCTTCCTCCTCAGGAAGACTCTAGCTGGCAAAAAGACCCAGACTATCAGC
CACCAG
Sequence Type genomic DNA
Unitrap ID UNI1642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 108167417..108188263 612
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005698 (Ctcf) NM_007794 CCCTC-binding factor Gene [Source:MGI (curated);Acc:Ctcf-001]

 
Come back to gene ENSMUSG00000005698


For any suggestions or comments, please send an email to unitrap@crg.es