Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-S1-2A1
Clone ID FHCRC-GT-S1-2A1
Vector ROSAFARY
Project fhcrc

Sequence tag FHCRC-GT-S1-2A1
Sequence
GAGCAGTAGAGAACTCTGGACAATTCTACTTGGGAGGTCAGCTCTTAGAGAATTGGTGAGTTTTAGGGCTATAGACCCAT
TT
Sequence Type genomic DNA
Unitrap ID UNI14694

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30152168..30152249 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es