Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone FHCRC-GT-UAS-2G10
Clone ID FHCRC-GT-UAS-2G10
Vector ROSAbetageo*UAS
Project fhcrc

Sequence tag FHCRC-GT-UAS-2G10
Sequence
GCCAGGCCCCCACATTTTCATGTGATCAGCTCTGAGGCCAGAAGCTAAAACTCTATTTACACACCTCCAGACTCAAAGGA
AGAGGAAACACTCAGGAAGGGATGGAGAGATGGACAGAGCTGAATGCCTGTGGGAAGCACGGAGAGAAGCAGAGGACTAT
ACTCGGTGAGAGGTCGGAGAG
Sequence Type genomic DNA
Unitrap ID UNI14695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25940271..25940430 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074274 (D930028M14Rik) RIKEN cDNA D930028M14 gene Gene [Source:MGI Symbol;Acc:MGI:3687343]

 
Come back to gene ENSMUSG00000074274


For any suggestions or comments, please send an email to unitrap@crg.es