Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11801A12
Clone ID IST11801A12
Vector VICTR76
Project tigm

Sequence tag IST11801A12HMF1
Sequence
AGTTCCAGGACAGTCAGGGCTATACAGAGAAACCCTGTCTT
Sequence Type genomic DNA
Unitrap ID UNI15571 UNI31660

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 17992277..17992317 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 4372570..4372610 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4148005..4148045 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3532511..3532551 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 29949070..29949110 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 82968002..82968042 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 80030363..80030403 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4011138..4011178 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 47338429..47338469 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064043 (Trerf1) NP_001091092 transcriptional regulating factor 1 Gene [Source:MGI Symbol;Acc:MGI:2442086]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 18731229..18731269 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22952253..22952293 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026781 (Acbd5) NP_083069 acyl-Coenzyme A binding domain containing 5 Gene [Source:MGI (curated);Acc:Acbd5-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 9220588..9220628 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 74651021..74651061 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 17040014..17040054 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 86684936..86684976 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28496649..28496689 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3551733..3551773 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109743179..109743219 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166310: 18563..18603 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49394645..49394685 41
NO GENE  

 
Come back to gene ENSMUSG00000026781


For any suggestions or comments, please send an email to unitrap@crg.es