Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0330
Clone ID AA0330
Vector pGT0lxr
Project sanger

Sequence tag AA0330
Sequence
GAGGACTACAAGGCGCCCACGGCCTCTAGCTTCACCACGCGCACGCCCCAGTGCCGGGACACCGTGGCGCCCATCGAGGA
G
Sequence Type mRNA
Unitrap ID UNI2455

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 17889048..17889128 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079167 (CT030170.10)  

 
Come back to gene ENSMUSG00000079167


For any suggestions or comments, please send an email to unitrap@crg.es