Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10921E6
Clone ID IST10921E6
Vector VICTR76
Project tigm

Sequence tag IST10921E6HMF1
Sequence
CCTCAACCTTCCATACTCACCCTGGAAGGAACTACCTCCATCCCATTATTCTTNACTCATTTTTCCCTTCACAAAAAACA
CAAATAAGGTCACATTGCCCTAACTTTTTATTATTANCATTATATAGCTAANGATTAAAAATACTAGTTA
Sequence Type genomic DNA
Unitrap ID UNI10340

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096182..58096330 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036986 (Pml) NM_178087 promyelocytic leukemia Gene [Source:MGI Symbol;Acc:MGI:104662]


Sequence tag IST10921E6HMR1
Sequence
GCAATACTCCCAGGAAGGCCNTGAACTAGGCTTCCTTAGGAAAATGAGCTTGGTGGCGCATACATTAATCCCAGAGCTCA
GAAGGCAGGCAGGTGGTTTCTATGAATTTGAGACCAGCCTGGCTTACAAAGCAAGCTCCAGCCCGGCCAAGGCTACAGAG
TGAGACCCTGTGTTCCAAAAGATAAAATAAAATANATCCCTAAACCTCATACACATAAAATAAATTGATGAAAATCAAAA
GAGAAAGCANCTGTGTGAATCCTGTTGGTCTTAGCAGGCACTTTGGTCTGANCCANGTTCTGTCTGTTTGTTTGTTTTGT
TTTGAAACAGGTCTTGCTGTGATGCCCTCAGCGGTCTTGAACTCTCTTTGTGGCCTAGGCTGGCCTGGAACTTGTCATCC
TCCCTCCANCCCTACCATCCCANGCACTATTGCTCCTGGNANGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58096330..58096773 426
 
EST/CDNA Est Name
  CN675108.1 - BY212900.1 - BY221010.1 - BB844245.1 - CN671058.1 - CF907242.1 - CN677934.1 - CN676012.1 - CN677667.1 - CN680881.1 - CN677966.1 - BY218454.1 - CD539987.1 - CD541369.1 - BB659153.1 - BY722732.1 - BB665920.1 - CD543286.1 - CD543529.1 - CA569055

 
Come back to gene CN675108.1 - BY212900.1 - BY221010.1 - BB844245.1 - CN671058.1 - CF907242.1 - CN677934.1 - CN676012.1 - CN677667.1 - CN680881.1 - CN677966.1 - BY218454.1 - CD539987.1 - CD541369.1 - BB659153.1 - BY722732.1 - BB665920.1 - CD543286.1 - CD543529.1 - CA569055


For any suggestions or comments, please send an email to unitrap@crg.es