Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AA0179
Clone ID AA0179
Vector pGT0lxr
Project sanger

Sequence tag AA0179
Sequence
TTTTTTAATCTCTTCATCAGTAATCCCTTTATCCTCTCTCTCCGATCTCTCTTTTTCTTTACCCGATCGCCATCATTTCT
CCGGCTCTCGTCTTTCCATTCTCTCCGCTCGTCTCTCTTTTGCTATTTCCTTATCTTTTTTCTTCATTAATCTTCCTCTT
TCCTGTTCCATATATTTCATTGTAATTCCACTTTCTCTTTGTCTCATCTCCTTTCCGTGTGGCTGCCCCTTCCTTTCTTC
CTTCTCGCTTTTCTCCATTCTTCTCCTTCGATTTTCTTCTTGGTTACTCTTTTTCCCTTCAGAATTCCGTCTTCAGCTTC
ATGCTCTATTTTTTTTCCTCTTGTCCTCTTTTGTTTCTGTCTCACTAGCGCAGCCGCCGCCGCCGCGGACAATGAGAGGT
CCCATCTGATGCCAAGGCTGAAGGAGTCTCGGTCACACGAGTCCCTGCTCAGCCCCAGCAGCGCAGTGGAGGCCCTGGAC
CTCAGCATGGAGGAGGAG
Sequence Type mRNA
Unitrap ID UNI2456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 35517114..35563267 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026883 (Dab2ip) NM_001001602 disabled homolog 2 (Drosophila) interacting protein Gene [Source:MGI (curated);Acc:Dab2ip-002]

 
Come back to gene ENSMUSG00000026883


For any suggestions or comments, please send an email to unitrap@crg.es