Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14726F7
Clone ID IST14726F7
Vector VICTR76
Project tigm

Sequence tag IST14726F7BBF1
Sequence
GGATTATGTCAAGAATGCTGAGACAGGAGACAGCCCAGGATCATGAGTTGAGCCCCACCCTCATCCCCTTGCTGTCACAG
ACATTTTTACAAGAAAGGGGAGGGTGTAGAGGAGGAATAGAGACAGCTCCACTGGGAAGGAGAAGCTTCCCAGAGGCAGA
GGTGGGAGTCTCAGCAGCAGGAGAGGCCAGGAGGAAATCTCTCCTTAGTCCCCAGCCTGGCCCTGCCATGCCTGAACTTC
CNAGTGACTCCTCATTTGGACTCTGGTTCTAGTCTACCTAGTCTGTAAGTACCTAGTCTACAATGACCCAGGGCACTAAT
ACACCNACAGCAGANCAGCCCANGGTCACAGGCATTCNTTGNCNNCNAACTCTTNTN
Sequence Type genomic DNA
Unitrap ID UNI22918

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 36125938..36126311 356
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029095 (Ablim2) NM_177678 actin-binding LIM protein 2 Gene [Source:MGI (curated);Acc:Ablim2-007]

 
Come back to gene ENSMUSG00000029095


For any suggestions or comments, please send an email to unitrap@crg.es