Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14491C6
Clone ID IST14491C6
Vector VICTR74
Project tigm

Sequence tag IST14491C6HMF2
Sequence
GGATTAAAGGCGTGCGCCACCACGCCCGGCTTCGGTTTGTTTTTTGTTATCTATTTTTACTTGTATGTGCGTGAGTGCGC
TGTACTGTAGCTATGTGCAGGCTTCTAGAGAAGGCAAAAGAGACATCANAGCTCANGAAGCTGGAATTACAGGCAGTTAT
GTATGAGCCATGGACATATGGGTGTTGANANNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6058623..6058810 184
NO GENE  


Sequence tag IST14491C6HMR1
Sequence
CCAGCACTCGGGAGGCANAGGCAGGCGAATTTCTGAGTTCNAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCA
GGGCTATAAAGAGAAACCCTGTCTCGGAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 177065653..177065777 121
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6058499..6058623 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14491C6BBF1
Sequence
GGATTAAAGGCGTGCNCCACCACGCCCGGCTTCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es