Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11015G5
Clone ID IST11015G5
Vector VICTR76
Project tigm

Sequence tag IST11015G5HMF1
Sequence
ATCTTTATAGCTGGAAAGTGACTAAGTACTGGGGGGAAAAAAGCCTATCAAAACTGTGTAAGTATACTAGGATGTCTCTG
AGACACAGGTGTAAATTATAAGCTTTCATGAAGGCCTCTAAAGACTATCCAGTCACTTGGGCATTTGCTTCTAACAGCAG
CCATTGCCTGGTTGTTCTCCTGGANAACTGTTA

Sequence Type genomic DNA
Unitrap ID UNI32258

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 149807748..149807939 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074736 (OTTMUSG00000015750) NM_001085521 predicted gene, OTTMUSG00000015750 Gene [Source:MGI Symbol;Acc:MGI:3702158]

 
Come back to gene ENSMUSG00000074736


For any suggestions or comments, please send an email to unitrap@crg.es