Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12102H2
Clone ID IST12102H2
Vector VICTR76
Project tigm

Sequence tag IST12102H2BBF1
Sequence
ACAGTAACAATCCTCTGTTTACTAGGTAGGAGTCCTTCTGTTGACTCTTTGGACATAACAAAAAATAAAATAAATCAGTT
TTTTTTAAAGGAAAGTTATTTTTTTAAAAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI31181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 150355905..150356019 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029658 (4930434E21Rik) NM_029440 RIKEN cDNA 4930434E21 gene Gene [Source:MGI Symbol;Acc:MGI:1923042]

 
Come back to gene ENSMUSG00000029658


For any suggestions or comments, please send an email to unitrap@crg.es