Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12788B8
Clone ID IST12788B8
Vector VICTR76
Project tigm

Sequence tag IST12788B8HMF1
Sequence
CAGGGTGTGCTTGACAAAGTCCCAAGTGCTCAGGACTTTTAGCCCTGTCTACTTTGGCTTGGTTTGGATGATTCTTAAGT
TTATTANCCTAGTGATGGA
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95465264..95465361 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]


Sequence tag IST12788B8BBF1
Sequence
AGAGCACTGGCTGCTCTTCCAAAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTGACAACCATCTGTAACAAGA
TCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 168643702..168643785 82
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133387138..133387221 82
NO GENE  

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es