Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10905G11
Clone ID IST10905G11
Vector VICTR76
Project tigm

Sequence tag IST10905G11HMR1
Sequence
GGTCNAGACCNGGATCTCTCTCCTGGGAGCCNACAGGAGCCTTCCAAAATTATCAGGGAAAGAGGTTTTCTGTCCTCAAT
CCAGCTTGGGAGAGATTTTGTTACTGACACATGATCCTTCCCCCACCCAGTAATGAAGTGTTCTGTGTGCTAACAATATA
GCTTAAAAAAAAAAAAANTAAAAA
Sequence Type genomic DNA
Unitrap ID UNI32250

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8288817..8288999 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052551 (Adarb2) NP_443209 adenosine deaminase, RNA-specific, B2 Gene [Source:MGI Symbol;Acc:MGI:2151118]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22125274..22125456 175
 
EST/CDNA Est Name
  AV123113.1 - CB934381.1 - CF352273.1


Sequence tag IST10905G11BBF1
Sequence
NACCTAGGTGGCCACCAAGGCACAACAATGCCTTGTGGTCTGGGAAAACTATAAATTCACTTTTATATCCTCTTCCCCCT
GTACTATCAACATAGACTTAATTCCCTTAAAAACCAGAGACCTGTTGGAACCTGGCCCCCAAAATTGGTTTCCCAGTCCA
TTGAGTGATGGGGACTTTGCANTGACTTCATTGAGTGTTCTNANAANAGCACTGGTTCCTTTTATAAAAGATTGTGGATC
TTCANATTGATAATTCTGCCTAAAAGTCAGGGTCGGCTTGTGAAAAGTTGTTAAAACAACATCCTTAATGTGAAATGTCN
NCCCTCACTCTAAGCTACTTCCCCCTTTTCAAAGCATTGAATGAAGACTTCATTGGGTTTNATAGTGGCTTTCTGATTTT
GGTAGTCTATACNAGAANGGAATTTGGAAGTTCTTGTATATTGTTGATTGTCTGCCCATGTCCTGNCTGANATACCATGA
TTGTTTANNAAAAGAATCTTN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22124778..22125276 471
 
EST/CDNA Est Name
  AA221562.1 - AA432887.1 - AA015391.1 - CX205971.1 - AA617061.1 - BY401231.1 - AV313503.1 - CJ302231.1 - BB717667.1 - AV144035.1 - BB812968.1 - BB817366.1 - BB688870.1 - BY658758.1 - AV000699.1 - AV037224.1 - BY426816.1 - BY441437.1 - BY655652.1 - BB686939
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 84552888..84553386 471
 
EST/CDNA Est Name
  BB560294.2 - BU707304.1 - BG805733.1 - CN457221.1 - CO427452.1 - CF952113.1 - CN455721.1 - BQ570906.1 - CX226154.1 - CF952079.1 - BF141365.1 - DN174619.1 - BM946371.1 - CF731521.1 - CV560351.1 - CO427264.1 - CF951944.1 - BQ177646.1 - AA269854.1 - AA511908

 
Come back to gene BB560294.2 - BU707304.1 - BG805733.1 - CN457221.1 - CO427452.1 - CF952113.1 - CN455721.1 - BQ570906.1 - CX226154.1 - CF952079.1 - BF141365.1 - DN174619.1 - BM946371.1 - CF731521.1 - CV560351.1 - CO427264.1 - CF951944.1 - BQ177646.1 - AA269854.1 - AA511908


For any suggestions or comments, please send an email to unitrap@crg.es