Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15481-NR
Clone ID PST15481-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15481-NR
Sequence
TTTTTAAGATATACTAGGTTTAGTTAGTATCACACACCTTCAATCCCAGCAGAGTCAGCCTATATTCTGAGATCAAGGCT
AGTAAGGCTGTAATAATAATTGGCTAGATGTTTAGCAGGTAAAGGTGACTACTGCCAAACTTGGAAATGTGAATTTAAAT
TTTCAAAACCCATATAAATAAAGGTGGTCAGGAGGAGAGAATTAACTTTAAAAAGTTGTTGTCCCTTGCCCCTTTATATG
TGCCATGCCATACGCATGAACATACACAAGTATGTAAATATTAAACAAATTTTTAAATGAACTCCTCTAGAAGGGAACAC
AGAATAGCTAATTAATAAGAATTTAGGCGCTGGGGGGCAGTGGTGGTACATACCTTTAATCCCCAAGCACT
Sequence Type genomic DNA
Unitrap ID UNI483

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77522024..77522403 371
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037857 (Nufip2) NM_001024205 nuclear fragile X mental retardation protein interacting protein 2 Gene [Source:MGI (curated);Acc:Nufip2-001]

 
Come back to gene ENSMUSG00000037857


For any suggestions or comments, please send an email to unitrap@crg.es