Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15471-NR
Clone ID PST15471-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15471-NR
Sequence
TACCAGAGCATACGGGTACGTTGATTATTATACCTTTTCTAGACCATTATGATTAATGAAAAGTGTTGCTAAATATTAAG
ACTAAACCACTCTTAACTGAATGACTTCCCAGTCAGTGGCTCCTCTCCACTGTGTGTCTACAAATGTTTTTTTCCCTCTT
AAAGCGTCCTTGAGTCATTTTAGTAAGACTGTTAGTGTCCTAGCCTACACATCTTCATCACAGACAGGGAAGCTCAGTAG
CCGAAGACACCGCATTCCTGTTGACCAAAAAAAAAAAAAAAAAAAAAACCCTAACAAAATATTCCCTCTATTTAGGAGAG
AGGGAGATT
Sequence Type genomic DNA
Unitrap ID UNI14706

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 31670980..32262950 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027663 (Zmat3) NM_009517 zinc finger matrin type 3 Gene [Source:MGI (curated);Acc:Zmat3-001]

 
Come back to gene ENSMUSG00000027663


For any suggestions or comments, please send an email to unitrap@crg.es