Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10513B2
Clone ID IST10513B2
Vector VICTR76
Project tigm

Sequence tag IST10513B2HMF2
Sequence
GTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTCATTACNGGTGGTTGTGAGCCACCATGTGGTTGCTGGGAT
TTGAACTCCAGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCCACTGAGCCATCTCACCAGCCCCTAATATTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 58306609..58306760 144
NO GENE  


Sequence tag IST10513B2BBF1
Sequence
GTAGCTGTCTTCCGACACTCCAGAAGAGAGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI29342 UNI30995 UNI30996 UNI31575

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 193225758..193225797 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 82379729..82379768 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053302 (AC124384.4) Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q3UWJ8]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14619204..14619243 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65725992..65726031 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23000047..23000086 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040420 (Cdh18) cadherin 18 Gene [Source:MGI Symbol;Acc:MGI:1344366]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16028767..16028806 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 38138940..38138979 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 87659632..87659671 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 87761479..87761518 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143651994..143652033 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25705615..25705654 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040940 (Arhgef1) NP_001123622 Rho guanine nucleotide exchange factor (GEF) 1 Gene [Source:MGI (curated);Acc:Arhgef1-002]

 
Come back to gene ENSMUSG00000040940


For any suggestions or comments, please send an email to unitrap@crg.es