Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10513F12
Clone ID IST10513F12
Vector VICTR76
Project tigm

Sequence tag IST10513F12HMF1
Sequence
TTAGTGCTGGTATTTTTAGTCNTGGCATAGGCTAGGGGCTTCCAGTGATTAACACCCCACTCTGGGGAGCAATGGAGGCC
AAAGCTCTTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI11698

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 123376044..123376138 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029475 (Fbxl10) NM_001003953 F-box and leucine-rich repeat protein 10 Gene [Source:MGI (curated);Acc:Fbxl10-003]


Sequence tag IST10513F12BBF1
Sequence
ATTTTTTTTGTTGAGGGGTGACGTTTGCTGATTTTCTTTTACGTAAGAGTTTTCANATATTAACCTTTTCGTTGCTTTGG
CCTACCTATTGAATTAAAGAACTGCTTTTTGTCTGTTAGTCTTTCTGGATGTAATGAAGGGGATGTGTGGTTATGAAAAT
TTTGGTTCCTTACCAGATGGGTTTATTTTTGGGATCTGAGATGTAGGAAAGCANAAACCTTTTAAACCCTTTAAAAAAGC
AAAAGGACATATTACAGTGTTTTAAACATTCTGACGTTAGCAGTAGTATCTTGCTTATATTAAGGTCAAACATTATAATG
GAAGTTTNATAATGAACTTTGCTTAAGATGAAATTAGGATTTTTGAGACTTAGCTTCTGGGAATAGGATTTTAGAGTTTT
CAAAAATGATTTTGAAACATTAGGTGTCCATAGGTAAGAAACNAATTCCCATGTGCTGCTGATCCCCACTAATATTGCTT
ATGGTTNNNAGTGATAAANGAAGTTTTTCTTTANNAAATGGN
Sequence Type genomic DNA
Unitrap ID UNI10517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 73602477..73602997 501
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070733 (Fryl) NM_177136 furry homolog-like (Drosophila) Gene [Source:MGI (curated);Acc:Fryl-001]

 
Come back to gene ENSMUSG00000070733


For any suggestions or comments, please send an email to unitrap@crg.es