Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13639D3
Clone ID IST13639D3
Vector VICTR74
Project tigm

Sequence tag IST13639D3HMR1
Sequence
GGACATGACTTTGTTACAGCCATTATTGAAGTTGTGATGTGTCCAGCTTGCTTCCTGAAACCTTGATCTTTGCATAGTAA
CAAGGCACCTGCCCACCCCTTTCCAGGGGCTACTTTTTCCTACTTATAATTTATGAATCC
Sequence Type genomic DNA
Unitrap ID UNI1776

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54337239..54337377 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037533 (Rapgef6) NM_175258 Rap guanine nucleotide exchange factor (GEF) 6 Gene [Source:MGI (curated);Acc:Rapgef6-003]


Sequence tag IST13639D3HMF1
Sequence
GTCCCAGAGTGTTACCCAAAGTTTGAGACTTTCTATGCAAAGAACTCTAAGTATGAAACTCCCGTGACTAAAAATTAAAA
CATTTCATTTCNNTTACTGCAACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 54337138..54337242 101
NO GENE  

 
Come back to gene ENSMUSG00000037533


For any suggestions or comments, please send an email to unitrap@crg.es