Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14445H5
Clone ID IST14445H5
Vector VICTR74
Project tigm

Sequence tag IST14445H5HMR1
Sequence
GAGTCNTAGCTCTGTACCAAATTCACAAACTTTGTATTAAAATTCAGATGACCCCATTTTCCCCTTGGATTAAAAAAGGG
GGGCAGGGATATGACTTCGGAAGTACAAGTAATTTCCTAAGGACCAGCTAATTAACTGTTAAACATCAGCTTTCCNGAAG
TACAGTGCTGTGGGTGGCTGGAAAGTANAGTTC
Sequence Type genomic DNA
Unitrap ID UNI29874

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22431647..22431838 186
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


Sequence tag IST14445H5BBF1
Sequence
ACTCTACAATGAGATTTAACACTCCCTCTCCTTAGCATAAACTATTTCAGTTACTCAAGATGCTGGTTGTTATTACAAAT
GCTACTGAAACAAATGAGATGGTTTAAAGAAAAAAAAAAATCNNNNTTNAANCCNGCNTTGAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es