Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15423-NR
Clone ID PST15423-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15423-NR
Sequence
CTCAGAACGAGTACCATCTCCTGGACACGCCCTGTGGTTGGTGCGGCAGGATCATCCGCTGGTCCCAGCTCTCTGAGGGT
TCCACTCCTGTCTCTGCAGCCTACACAGATGACCTGGGTGCTGTGGGTGGTGCATG
Sequence Type genomic DNA
Unitrap ID UNI14707

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143142715..143142850 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029578 (Wipi2) NM_178398 WD repeat domain, phosphoinositide interacting 2 Gene [Source:MGI (curated);Acc:Wipi2-001]

 
Come back to gene ENSMUSG00000029578


For any suggestions or comments, please send an email to unitrap@crg.es