Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12508H10
Clone ID IST12508H10
Vector VICTR76
Project tigm

Sequence tag IST12508H10HMF1
Sequence
ACGTGACCAGAAAATGGAGGCGAATCTGTACTTGGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI34554

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 17211256..17211297 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039126 (A230083H22Rik) BNIP2 motif-containing molecule at the C-terminal region 1 [Source:UniProtKB/Swiss-Prot;Acc:Q52KR3]

 
Come back to gene ENSMUSG00000039126


For any suggestions or comments, please send an email to unitrap@crg.es