Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14105C12
Clone ID IST14105C12
Vector VICTR74
Project tigm

Sequence tag IST14105C12HMF2
Sequence
CGATGTTGAGCAGGCTGGTCTTGAACTTCCTCAGCCTCCTGATAGGTAGAGGATACAGGCAACACCTGTTTTCTGTTTGG
AGATTTTTAGCTTTGAGTCAGGCTGGTTTCAAATCCTTCAGTATCCAGCTTCACCATCCACAAAGAAGCAACTATGGTTT
TAAATACAGACAACTAAGACATGAAGTAAAACCTAGAAGTCATACTGAACTGTAAGTAAATGAGCATGAATGCCTGGTAT
TAACCAGCCNATACTGCTCAATATTCCATTTAAAAAAAAANAAATTTNTTTNANTNGGNTNNNTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 103122547..103122844 284
 
EST/CDNA Est Name
  CN671503.1 - CD543786.1 - BB844121.1 - AW229499.1 - AA795462.1 - DT912674.1


Sequence tag IST14105C12BBF1
Sequence
TTGTAAATGCGCACTTGTTAGATTAGAGACTTGGTCAGAGTCGGTCGTATTTGAAGGTGAGCTGGCTGCTTTACTGAGGT
CNGCTAN
Sequence Type genomic DNA
Unitrap ID UNI31775

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88246519..88246604 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028064 (Sema4a) NM_013658 sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A Gene [Source:MGI (curated);Acc:Sema4a-001]

 
Come back to gene ENSMUSG00000028064


For any suggestions or comments, please send an email to unitrap@crg.es