Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST15379-NR
Clone ID PST15379-NR
Vector U3NeoSV1
Project escells

Sequence tag PST15379-NR
Sequence
GGCTTGGATTAAATTCATGGGATTAAATTCCTGGTGATTCCAGTACTGTTTATTAGTGCACACTTTGGCCTCAAATAGTT
CAAGGCAAGTGACAATAAGAAGCATAGGAAATGTTGTTTTTTAAAAGTGCTAATCCATACCACATAATTCAAAAAGCCA
Sequence Type genomic DNA
Unitrap ID UNI14715

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 96096121..96096277 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041995 (Zbed3) NM_028106 zinc finger, BED domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1919364]

 
Come back to gene ENSMUSG00000041995


For any suggestions or comments, please send an email to unitrap@crg.es