Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14699E10
Clone ID IST14699E10
Vector VICTR76
Project tigm

Sequence tag IST14699E10HMR1
Sequence
GGAGCAAAGGCATGCACCACCACACCTGGGTGGTGTTAGAACAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAGTAAATAA
ATAAATAAATACAGATGAATAAATAAAAATAAATAAATAAATAAATG
Sequence Type genomic DNA
Unitrap ID UNI33172

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20554557..21504921 56
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070777 (Ceacam20) NM_027839 carcinoembryonic antigen-related cell adhesion molecule 20 Gene [Source:MGI Symbol;Acc:MGI:1918851]


Sequence tag IST14699E10HMF1
Sequence
AGGCCTTTACAACTTGCAATTACATACATTAAATTACTTTCTTAGATCCCCATGGCTTATATAAACTTCAAACCTTTTCT
TTCCACCTATTTGAGACACAATTTGCTGATTTTTGAGAGCAGTCATTGCAAAAGAAATTATTTTTTTTAAAAATTATTTA
TTTATTATATTATATGTAAGTACGCTGTAGCTGTCTTCAGACACTCCAGAAAAGGGCATCAGATCTCGTTACGGGTGGTT
GTGAGCCACCATGTGGTTGCTGGGATTTNAACTCAGGACCTTTGAAANAACANNNNNTGCTCTTACCTGCTGANNCATCT
NAN
Sequence Type genomic DNA
Unitrap ID UNI19786

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 100445397..100445716 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031325 (4930519F16Rik) RIKEN cDNA 4930519F16 gene Gene [Source:MGI Symbol;Acc:MGI:1922356]


Sequence tag IST14699E10BBF1
Sequence
AGGCCTTTACAACTTGCAATTACATACATTANNNNACNTTCTTAGATCCCCATGGCTTATATAAACTTCAAACCTTTTCT
TTCCACCTATTTGAGACACANNNNGNTGATTTTTGAGAGCAGTCATTGCAAAAGAAATTATTTTTTTTAAAAATTATTTA
TTTATTATATTATATGTAAGTACGCTGTAGCTGTCTTCAGACACTCCAGAAAAGGGCATCANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031325


For any suggestions or comments, please send an email to unitrap@crg.es