Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10731E6
Clone ID IST10731E6
Vector VICTR76
Project tigm

Sequence tag IST10731E6HMF1
Sequence
AGGGAACAGTATGAGAAAGGTCCCGTGCTGCTTCCCAACTTCTTCCTTACAGGTATCAGAGTTAGTGGAGCCTGCCGATA
ACCTAGATATGGAAGAACTCATTCTACACATTCAGTATTAGCCTTCGCTGGCTTCTGGATTGACTACGCTGGAATGACAA
ACGGCATCTATTGTTTCTATTTTGATGACAGAATGGGAATAACAGANAAAAACTATTTTATTTTTAAATGACTCCTGTTA
AAGTGAGACTTAAAAGCTCAGAGGAACACANAACTTTTCACCTTAACTTTTTGTTTTTTTAGTTACGCTACCTCCAGATT
CCAGCTTCGTCGCTGATTTTCATACTCAGTACATTACCTCTCAAACCCTAAGTGTTCCGTTTGATACCAGCTGATATTTC
AGCATGCATAAAGATTTCATTGCGAATGTCC

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84775898..84776327 426
NO GENE  


Sequence tag IST10731E6HMR1
Sequence
CCTCAGTGCCAGAAGGTCTGGCATTTCAAGCGTGTTTTCTTCCCTTTTAACACATTTAAAACTTTCAAAAACAATTCAGC
TGTAAAGAAAGGGGACATTANCATAGATAGTTCCCATATACTCTATACCCAGTTACCACCATTACAGTCTTATTATTATA
TAGTGTCACATGGGATACTCTGCTTAGATCTTCCTCATTCTTATGGAATGTCCTTTTCTGTCCCGGGATACCACATTTGG
ATTAACGGTCTTCTTCCTTTATGCTCCTCTTGGCTGTGGCANTATTTNNNACACCCCTTGTN
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84776325..84776625 291
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]

 
Come back to gene ENSMUSG00000053062


For any suggestions or comments, please send an email to unitrap@crg.es