Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12024A9
Clone ID IST12024A9
Vector VICTR76
Project tigm

Sequence tag IST12024A9BBF1
Sequence
TTCACAACAAGAACAAGAAAATGTTTATTCTAAAGGTGTTGGAGGCAGGTCCCAGCAGGCAAGATGACATTTGCTGTGTT
CTGTTACAGGACCATTAGTATCCCTGAGCTGAATAGTAAGAACACAGCCCCTCCGTCCGTCAGCAGCCTTCCTTAGGTGC
AGGTGGTCTCAATGCCTAACTAAAGAGTCCCAGCACACACATTTGCCTCTTTCTTATTTTATGCATTGTTAATGTTCTTT
CCACATACAGCAATGCTGTTTGATTTACACCAATGATAGTTAGAGATAGAAAGCTTCCACTTAAAATAAGCGCTCTTTTT
GTTTCNAAACTGAGTTGANCTGGGCGTGGAGACTCACAGTGCATGGGAGGTGGAGGCANGAGGATTGCTGCTANTTNNNG
GCNTACNNAGTGANANACCCTTTTTTGAAACAACAACAACNACNNCNACAAAANTT
Sequence Type genomic DNA
Unitrap ID UNI30994

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 10375357..10375809 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039179 (Tekt5) NP_001092745 tektin 5 Gene [Source:MGI (curated);Acc:Tekt5-001]


Sequence tag IST12024A9HMF2
Sequence
ACTTGAGACCGTGCGGTCTGCGGGAGTGCGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI31806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148274447..148274480 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es