Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12575H12
Clone ID IST12575H12
Vector VICTR76
Project tigm

Sequence tag IST12575H12HMF1
Sequence
GGAACATGTAGTGTGAAGTGCCCTGTTGTGTGTTCANACCCAAGGCTACAGTGAAGTCATGTGATGTACTATGGGCAAAT
GCTGCCAAAGCACCTCANATTCATGATACATTTGATCTTGAATTTACGTTTGGTTGTTTTANAAACCTCACAGTTTAAGA
AGTTAGATTTGGCCGGGCGGTGGTGGCACACAACTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGCANATTCTGAGTTT
GAA
Sequence Type genomic DNA
Unitrap ID UNI7787

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 29313011..29313252 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026799 (Med27) NM_026896 mediator complex subunit 27 Gene [Source:MGI (curated);Acc:Med27-001]

 
Come back to gene ENSMUSG00000026799


For any suggestions or comments, please send an email to unitrap@crg.es