Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14401F2
Clone ID IST14401F2
Vector VICTR74
Project tigm

Sequence tag IST14401F2HMR1
Sequence
TTCTCCTTCNAATTCATAGCCTATTTNATCAACTCTCATTGTATACATATATGTATTTGTGTATATATACATTTCTAAAT
ATAACCTACTAAGTCTGCATACTGTTACATATATAAATATTTTTAGGAATACTGTCATGATTTTTCAGAATGAGTCATGA
TGTGTGGGAGGCTCCCCCTAATCCTTGTTAAATANAACATGCCAATCTTTTCAGTTTTNANATGTAANATGGAAAAAAGT
GCCCCAAAAGATAGATGTAAGCACCCACAGCTACTCTGCNNCNNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25524432..25524709 266
NO GENE  


Sequence tag IST14401F2BBF1
Sequence
GTACCAAGCCCAGCACTGATCCATAAAAGTCCTGATTTCCTGCTCAGCGCAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI13119

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 126804923..126804979 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025405 (Inhbc) NM_010565 inhibin beta-C Gene [Source:MGI Symbol;Acc:MGI:105932]

 
Come back to gene ENSMUSG00000025405


For any suggestions or comments, please send an email to unitrap@crg.es