Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14379C7
Clone ID IST14379C7
Vector VICTR74
Project tigm

Sequence tag IST14379C7BBF1
Sequence
CCATAACTAGGATGTTTTTCTTCATAGAGCCTTTCGAGAGTTAAAGATTCAGAGAGCTAGCTAAGGGCCCCGAGTGGGTG
GAGCCTCTCTCCCGGGCTCCAGCAGCGTAGGAATGTCTAGTGCCTTGCTTATCCCTACCAAAAAGGTAAGGAGCTAGAGG
GTGGGGGTTGGGTANTCNCAGAACAGCNCACCTATCTCANCCTGGGGATTCTTGCNCNNNGTCCCTGGGAAGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95121706..95121940 219
NO GENE  


Sequence tag IST14379C7HMR1
Sequence
NTGGGACGGCTTGGAGATGGCCCAAGGCTAGGGTTGCCTGTGTGCTTGATTTTAGGTCTCACTGGAGGAAAAGTTANGCA
CTGAGGAACACAGTAGCCAGGCGACAAGGTCAGGAATTATTCCCTATTTCCTATCCAGTTC
Sequence Type genomic DNA
Unitrap ID UNI14367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95121938..95122076 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015714 (Lass2) NM_029789 LAG1 homolog, ceramide synthase 2 Gene [Source:MGI (curated);Acc:Lass2-001]


Sequence tag IST14379C7HMF1
Sequence
CCATAACTAGGATGTTTTTCTTCATAGAGCCTTTCGAGAGTTAAAGATTCAGAGAGCTAGCTAAGGGCCCCGAGTGGGTG
GAGCCTCTCTCCCGGGCTCCAGCAGCGTAGGAATGTCTAGTGCCTTGCTTATCCCTACCAAAAAGGTAAGGAGCTAGAGG
GTGGGGGTTGGGTAGTCACAGAACAGCACACCTATCTCAACCTGGGGATTCTTGCGCTGTGTCCCTGGGAAGTGAANACT
GCTGGNGNNNTNNNNNCNGGGCTTCAAGCTTGATGTGTNNNTNNNTGTTGTTNTGAACTTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000015714


For any suggestions or comments, please send an email to unitrap@crg.es